| Name | S06A01NCLL0022_N14 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_Q2H651 (80%/20) |
| Cluster: Putative uncharacterized protein; n=1; Chaetomium globosum|Rep: Putative uncharacterized protein - Chaetomium globosum (Soil fungus) |
|
| Ontology |
| GO:0005622 |
C |
intracellular anatomical structure |
| GO:0005634 |
C |
nucleus |
| GO:0000463 |
P |
maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) |
| GO:0000466 |
P |
maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) |
| GO:0030687 |
C |
preribosome, large subunit precursor |
|
| Orthologue |
|
Sequence (Nucleotide) | gcacgagggtggcatggtgtcggcgtaagtcggccgctaagcaaccacaatgccgcagaa
cgaatatattgaacgccatcaaaagctttacggcagacggcttgattatgaggagaggaa
acgcaaaaaagaagcgcgtgaaccccataagaagggctgagaaggctcgtaaactacaag
gtattaaagccaagatctaccaataaggaacgtcg
(215 bp) |