| Name | S06A01NCLL0021_J12 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_P45594 (95%/20) |
| Cluster: Cofilin/actin-depolymerizing factor homolog; n=10; Pancrustacea|Rep: Cofilin/actin-depolymerizing factor homolog - Drosophila melanogaster (Fruit fly) |
|
| Ontology |
| GO:0000910 |
P |
cytokinesis |
| GO:0000915 |
P |
actomyosin contractile ring assembly |
| GO:0001736 |
P |
establishment of planar polarity |
| GO:0001737 |
P |
establishment of imaginal disc-derived wing hair orientation |
| GO:0003779 |
F |
actin binding |
|
| Orthologue |
|
Sequence (Nucleotide) | cggctgcaatttntcggcagaggaagattagtggtgcaatttttacgtgttttaacatca
aaaaatggcgtctggtgtgacagtatcggacgcttgcaaaacgacatacgaagaaattaa
aaag
(124 bp) |