| Name | S06A01NCLL0021_J02 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_UPI00015B4E4A (96%/29) |
| Cluster: PREDICTED: similar to ribosomal protein L10e isoform 2; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to ribosomal protein L10e isoform 2 - Nasonia vitripennis |
|
| Ontology |
| GO:0003735 |
F |
structural constituent of ribosome |
| GO:0005622 |
C |
intracellular anatomical structure |
| GO:0005783 |
C |
endoplasmic reticulum |
| GO:0005840 |
C |
ribosome |
| GO:0005842 |
C |
cytosolic large ribosomal subunit |
|
| Orthologue |
|
Sequence (Nucleotide) | gcacgaggcaatgggtgcgccgaccagtgagatgttatcgatattgtaagaataaaccgt
atcctaaatctcggttttgtcggggtgtgcctgacccaaagatccg
(106 bp) |