| Name | S06A01NCLL0021_H24 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_UPI00005A5F0E (90%/33) |
| Cluster: PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8); n=2; Canis lupus familiaris|Rep: PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) - Canis familiaris |
|
| Ontology |
| GO:0000166 |
F |
nucleotide binding |
| GO:0005515 |
F |
protein binding |
| GO:0005524 |
F |
ATP binding |
| GO:0005622 |
C |
intracellular anatomical structure |
| GO:0005634 |
C |
nucleus |
|
| Orthologue |
|
Sequence (Nucleotide) | ccagcgtactttaatgactctcaaatgcatgccacgaaagatgcgggtaccatctctggt
ctgaatgttcttcgtattatcaatgaaccgacagctgct
(99 bp) |