| Name | S06A01NCLL0021_F20 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_Q231I7 (36%/30) |
| Cluster: Adenylate and Guanylate cyclase catalytic domain containing protein; n=2; Tetrahymena|Rep: Adenylate and Guanylate cyclase catalytic domain containing protein - Tetrahymena thermophila SB210 |
|
| Ontology |
| GO:0004012 |
F |
ATPase-coupled intramembrane lipid transporter activity |
| GO:0004016 |
F |
adenylate cyclase activity |
| GO:0007242 |
P |
intracellular signal transduction |
| GO:0009190 |
P |
cyclic nucleotide biosynthetic process |
| GO:0016020 |
C |
membrane |
|
| Orthologue |
|
Sequence (Nucleotide) | gcacgaggatttattttttactaatcaaaagaaattcgaagaaattgtgcgggtaacttt
tcattataatgaataaatcttttcaataaatcttttatggctgctttatcgcttttgatt
tatttgtgtaatatccacactgctcgtttaagttggttcaaacgaagtacttttcgaagg
ttgacttgaagtccgaattacgtgtcccatacactcgt
(218 bp) |