| Name | S06A01NCLL0021_F09 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_UPI0000E2401A (55%/49) |
| Cluster: PREDICTED: similar to amidohydrolase domain containing 2 isoform 1; n=1; Pan troglodytes|Rep: PREDICTED: similar to amidohydrolase domain containing 2 isoform 1 - Pan troglodytes |
|
| Ontology |
| GO:0006044 |
P |
N-acetylglucosamine metabolic process |
| GO:0008448 |
F |
N-acetylglucosamine-6-phosphate deacetylase activity |
| GO:0016810 |
F |
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds |
| GO:0016787 |
F |
hydrolase activity |
|
| Orthologue |
|
Sequence (Nucleotide) | gtactgcacgaggtccacccagctaaagctttgggtatcgaaaaagagaaaggaaatctt
gactttggtagtgatgcggactttgtaatacttcatcctagttcattaaaggttttctct
acttggatagcgggagaatgcgtttataattgtaatagtgattaatatccatcatattat
gaattacatttgtt
(194 bp) |