| Name | S06A01NCLL0020_M05 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_Q41HP1 (37%/45) |
| Cluster: Putative uncharacterized protein; n=1; Exiguobacterium sibiricum 255-15|Rep: Putative uncharacterized protein - Exiguobacterium sibiricum 255-15 |
|
| Ontology |
| GO:0003677 |
F |
DNA binding |
| GO:0003700 |
F |
DNA-binding transcription factor activity |
| GO:0006350 |
P |
transcription, DNA-templated |
| GO:0006355 |
P |
regulation of transcription, DNA-templated |
| GO:0045449 |
P |
regulation of transcription, DNA-templated |
|
| Orthologue |
|
Sequence (Nucleotide) | cggcacgaggaacctccaacatgaggtatctggtaattctaggtgttggctgccgtttgg
atggtagaagggaatccgatgattctgcctgataacgactattttgatctcggtattcat
gaccaggtcctcggagtcttccgaatctctaactgattacatgaaattgagcgc
(174 bp) |