| Name | S06A01NCLL0011_P06 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_UPI000155314F (90%/21) |
| Cluster: PREDICTED: similar to ubiquitin A-52 residue ribosomal protein fusion product 1; n=3; Euarchontoglires|Rep: PREDICTED: similar to ubiquitin A-52 residue ribosomal protein fusion product 1 - Mus musculus |
|
| Ontology |
| GO:0004252 |
F |
serine-type endopeptidase activity |
| GO:0006464 |
P |
cellular protein modification process |
| GO:0006508 |
P |
proteolysis |
| GO:0016032 |
P |
viral process |
| GO:0019082 |
P |
viral protein processing |
|
| Orthologue |
|
Sequence (Nucleotide) | gcacgaggcgcccgtatcagcagacgtcttatctttgccggcaaacaactcaaagacggt
cgcactctttctgactacaacatt
(84 bp) |