Name | S06A01NCLL0002_C13 |
JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
UniRef |
UniRef50_Q23DS0 (40%/37) |
Cluster: Adenylate and Guanylate cyclase catalytic domain containing protein; n=1; Tetrahymena thermophila SB210|Rep: Adenylate and Guanylate cyclase catalytic domain containing protein - Tetrahymena thermophila SB210 |
|
Ontology |
GO:0004012 |
F |
ATPase-coupled intramembrane lipid transporter activity |
GO:0004016 |
F |
adenylate cyclase activity |
GO:0007242 |
P |
intracellular signal transduction |
GO:0009190 |
P |
cyclic nucleotide biosynthetic process |
GO:0016020 |
C |
membrane |
|
Orthologue |
|
Sequence (Nucleotide) | gcacgaggtgtattttgtttttctcgtgttatcattgcgagttaagatgggtttctagta
accaaacgtttgcacacccgcgtgtgcttacacgcaattaataaaaatgcttgccatcat
ggcgcccttaccggacagt
(139 bp) |