SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120043.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_Q03209 (89%/87)
Cluster: 61 kDa protein; n=6; Nucleopolyhedrovirus|Rep: 61 kDa protein - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0000166 F nucleotide binding
GO:0004672 F protein kinase activity
GO:0004674 F protein serine/threonine kinase activity
GO:0005524 F ATP binding
GO:0006468 P protein phosphorylation
Orthologue
Sequence
(Nucleotide)
GTTTTATGTCGTTGTGTATGAAATTGTGTTTGTGCAAATCGTTGAGCGCTTCACACAGTT
GTCTAATAATATTGCTAACAAGTTGGTGCGAAAGCTCGCCTTTAATTTGTAGCGTTTCAA
ATAAATCCGGACAGTCGATGTAGTCCATCACGATCACTTGGTTGTTAATGAAACCGTGAT
TAAAATAGATTTTTATAAAATTTGGGTGGTCGTTCATTAACTGGTGGACTTTTATTTCGT
CGACGTTAAAATTGGCGCCGAAATTGTTTTCTGCAAATACAATTTGCTAGTGGGCTTGTG
CGATAAAATAGATATTTTGCCAAAACGCCCGTTGATTATTTTATACCGAGTTTTGACGTT
TTTGCAGTTTTCGTAAAATTGTACCAGCGTTTGCAGCGTACATTTGTGGCGGTGGTGGTG
GCCATGACGAATCGTAAATATGAATCTGTACAATCTTATTTATTCAATAATAGGAACAAT
AAAATTGATGCACATCAATTTTTTGAACCGTCGATACTGCGGAAGCGCAAATTATCAAAG
ACAGCATTTACGACAACACAGTGTTGCTGAACAGAGATGTTTTTTTAAATATTTTAAAGT
TTGCCAACGACGTTTTTGACAACAAAGCGTACATGTACGTCGACGACAGCGAAGTGTCTC
GCTACTACAATGCTGTGGTAAAAATGAAAAGGCTTGTCATCAACGTGCGGGATCCGAGCT
TGAGACAATCCCTCTACAATACAATTGCTTACATTGAGCGATGTTAAATATCGGCACGGT
AAACGATAGCGAAATTACAATGCTTATAGC
(810 bp)

- SilkBase 1999-2022 -