SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120040.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P31354 (100%/84)
Cluster: Early 35 kDa protein; n=16; Nucleopolyhedrovirus|Rep: Early 35 kDa protein - Bombyx mori nuclear polyhedrosis virus (BmNPV)
Ontology
GO:0004866 F endopeptidase inhibitor activity
GO:0004869 F cysteine-type endopeptidase inhibitor activity
GO:0006915 P apoptotic process
GO:0006916 P negative regulation of apoptotic process
GO:0043027 F cysteine-type endopeptidase inhibitor activity involved in apoptotic process
Orthologue
Sequence
(Nucleotide)
ACCGAACGGTTATATTATAAATATTCAACGTTGCTTGTATTAAGTGAGCATTTGAGCTTT
ACCATTGCAAAATGTGTGTAATTTTTCCGGTAGAAATCGACGTGTCCCAGACGGTTATTC
GAGATTGTCATGTGGACGAACAAACCAGAGAGTTGGTGTACATTAACAAGATTATGAACA
CGCAATTGACAAAACCCGTTCTCATGATGTTTAACATTTCGGGTCCTATACGAAGCGTTA
CGCGCAAGAACAACATTTGCGCGACAGAATAAAATCAAAAGTCGATGAACAATTTGATCA
ACTAGAACGCGAATACAGCGATAAAATTGATGGATTTCACGATAACATCCAGTATTTTAA
AGATGAACACTATTCGGTAAGTTGCCAAAATGGCAGCGTGTTGAAAAGCAAGTTTGCTAA
AATTTTAAAAAGTCATGATTATACCGATAAAAAGTCTATTGAAACTTACGAAAAATACTG
TTTGCCCCAATTGGTCGACAAACACAACACTGCTACGTGGCGGTATGCGTGTTGAAGCCG
GGATTTGAGAACGGCAGCAACCAAGTGCTATCTTTTGAGTACAACCCGATTGGTAACAAA
GTTATTGTGCCGTTTGCTCACGAAATTAACGACACGGGACTTTACGAGTACGACGTCTTA
GCTTACGTGGACAGTGTGGAGTTTGATGGCAAACAATTTGAAGAGTTTGTACAAAAATTA
ATATTGCCGTCGTCGTTCAACGATTCGGAAAAGGTTT
(757 bp)

- SilkBase 1999-2022 -