SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120039.Seq
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf106
1120652 bp
UniRef
UniRef50_UPI0000DB74AD (39%/56)
Cluster: PREDICTED: similar to Nopp140 CG7421-PB, isoform B; n=1; Apis mellifera|Rep: PREDICTED: similar to Nopp140 CG7421-PB, isoform B - Apis mellifera
Ontology
GO:0004672 F protein kinase activity
GO:0005524 F ATP binding
GO:0006468 P protein phosphorylation
Orthologue
Sequence
(Nucleotide)
GTGGCGGCGTGGTTTACACTGTTGAAGCCGGAAATAAGGAGATTCACTAAATATTAGACA
AAAACTTCAAAATGAATTTAACTACAGAAATTCAAGCGGATGTGAATTCCTTAGTTCACC
AGTATTTAGAAAAAATTGACAAATCGCTGGCCCAGACCTTCATGAAGAAAACTAAAGCGA
AACCACGTGCCAAAAACCAACAGACCCTCTTAGACATCATTGCCAAGTTTAATCAAGGAA
ATAAAGCAAAAGCTAAAGTTCCAGTGACTCGAGCGAAGAAGATGCCCCTAAGAAACCAAC
AATTCAAACAAATGGGAAAGTTCCAGCAACTAAGAAAAAAGCTGAAAGTTCAGATTCTGG
TAGCTCCGATGATGAGCCACCAAAACAGGCATCTAAGCCCAACCAAGCAGTTAAAAAACT
TAACATTACACCAGCTAAGAAACAAGAATCATCAGATGACAGCGACAGTGATGATGATGT
TACGTCAAAACCTAAAAAGCAGCCTGTTAACCAATAAAAACAAATCCAGTACGTCCACCA
CAAAAAAAAGAGGAATCATCAGATGACGATAGTAGTGATGATGAATCTGAGAAAAAGGTT
CCACAAAAATCAGTTGTTACACCTGCCAAACTTCCAGTCAAACAAACTAATTCTAAAACA
CCTATTAAACAG
(672 bp)

- SilkBase 1999-2022 -