SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120038.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_Q80LM9 (35%/247)
Cluster: Major capsid protein VP39; n=1; Adoxophyes honmai NPV|Rep: Major capsid protein VP39 - Adoxophyes honmai nucleopolyhedrovirus
Ontology
GO:0005198 F structural molecule activity
GO:0019028 C viral capsid
GO:0019012 C virion component
Orthologue
Sequence
(Nucleotide)
CCGTGGTCCATATTTATAACGGCAACAATATGGCGCTAATGCCCGTGGGTATGGCGCCGC
GACAAATGAGAGTTAACCGCTGCATTTTCGCGTCCATCGTGTCGTTCGACGCGTGCATAA
CATACAAGTCACCGTGTTCGCCCGACGCGTATCATGACGACGGATGGTTTATCTGCAACA
GCCACCTCATCAAACGTTTTAAAATGTCAAAAATGGTTTTGCCCATTTTCGACGAAGACG
ACAATCAATTCAAATGACGATCGCTAGGCATTTAGTTGGAAATAAAGAAAGAGGTATCAA
GCGAATTTTAATTCCAAGCGCAACCAATTACCAAGAGGTGTTTAATCTAAACAGTATGAT
GCAAGCCGAACAACTAATCTTTCATTTGATATATAACAACGAAGAGGCGGTTAACGTTAT
ATGCGACAATCTAAAATATACCGAAGTTTCACAAGCGGCACGCAACGCGTTATACACAGC
GTTTACGCAACTACAAGAAGCATTCTAGCACCACAAACCCGAACACGTTTTGTTCGCGTG
TGTCGCGCGACGAATTGCGTTTTTTCGACGTGACCAACGCCCGAACGCATCGAGGTGGTG
TTGGCGATCAATTATTTAACAATTACAGTGGATTTTTGCAAAATTTGATTCGACGCGCAG
TAGCGCCCGAGTACTTGCAAATCGACACGGAGGAATTGAGATTTAGAAATAGCGCCACGT
GTATAATTGACGAAACGGGTCTGGTGGCGTCTGTGCCCGACG
(762 bp)

- SilkBase 1999-2022 -