SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120036.Seq
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_Q086L4 (32%/43)
Cluster: TonB-dependent receptor C-terminal region domain lipoprotein precursor; n=1; Shewanella frigidimarina NCIMB 400|Rep: TonB-dependent receptor C-terminal region domain lipoprotein precursor - Shewanella frigidimarina (strain NCIMB 400)
Ontology
GO:0004872 F signaling receptor activity
GO:0005215 F transporter activity
GO:0006810 P transport
GO:0016020 C membrane
GO:0016021 C integral component of membrane
Orthologue
Sequence
(Nucleotide)
TCACGAAAAAATACTAACATAAAAATTTTATCTTTTATCACCCTGTATAGTAATTGTAAA
AGGAGTATTTTTTTTACGAAAACAAACGTTTTTGTGGAACAATTCGAAAAACGTTTTGTA
GTTGAACTATTAACAGAATTTAATGAGAAATGATTGTAACATACGTTTAAGTAGAAGATT
GTTTAACATAAATTAGATCATACCGTCATAAATGTCTACATACTGTATCTATGTCATGTA
ATATACAGGATGTGTCGATCGATTCCCGAAAGCGAAGATAAAATTGGTGATAAGCTAGAT
CTAAAAAAAAGCACGAAAACAGTTCCGAAAGTGTTTTACACAGCACGCAATGTAATTTCG
ATAGTCAATTGACGCGCGGAAACAACGGGTTCGAAAGTTAAGCGGGGAGGCGGGTACTTT
TCGTTTCATTGCTGGTTCTCAAAAATCACAAGAACGTGTATTAATAATTTCCGTTTACGT
CGGTATAACGATTTAAGTCCACTTCAACTCGGGAATGTTCTTTATGAACCCTGTACGTAT
GATATGCAGAAATTGGGTAGTTTTATTTTGGTGTCCCTCTCAGCGCGGGATAAGTTAATT
TGTAAATCTTATCGCCAAAACTATGTTAATTTCAATGGTTGTCACAAAGCATTTAGTTTT
AGTTTATTGTTTGTTCGCTTAAGAATTCGATTTTATTGCCAATTATTACCATAGCACAAT
TTAAAGGGAAATTGT
(735 bp)

- SilkBase 1999-2022 -