SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120034X.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_Q9YML3 (56%/107)
Cluster: Uncharacterized Bro-N domain-containing protein J; n=1; Lymantria dispar MNPV|Rep: Uncharacterized Bro-N domain-containing protein J - Lymantria dispar multicapsid nuclear polyhedrosis virus (LdMNPV)
Ontology
Orthologue
Sequence
(Nucleotide)
CGTCGAATCGCCACGCGTCGTTGTAAATAAATTTAATTTAATAAATTAAAATGGCTCAAG
TTAAAATTGGAGAATTTAAATTTGGCGAAGACACGTTCACGTTAAGATACGTGCTCGGTG
ATGAGCAGCCAGTCAGATTTGTGGCCAAGGACATCGCCAGCAGTTTAAAATATGTAAATT
GTGAACGGGCAATACGTGTCCACGTCGACGGCAAGTACAAATCGACGTTTGAGCATGCCG
ACCAAATCCAGCACATGCTCCAGATAGCGTGGCAAAGCAGGGCGACCCGCTGTATTTGCA
CCCACACACAGTGCTCATTACCAAATCTGGCGTGATTCAACTGATAATGAAGTCCAAATT
GCCTTACGGCATAGAATTACAAGAATGGCTTTTGGAGGAGGTCATTCCTCAAGTGCTATG
CACGGGCAAGTACGCGCCGGCCGTTGAAATGGATACAAATGATGTTATTGCCAAAATTGA
CGATCTGACGCAAAAATTGACGGTGGCCACGCAGATTTTGCGGAAGCAACCGATCGCTCA
TTTTGTTTGCCAACGAAATGATTGTGGCTCGACGCGACGCTT
(582 bp)

- SilkBase 1999-2022 -