SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120033.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_O10312 (46%/91)
Cluster: Uncharacterized 42.5 kDa protein; n=12; Nucleopolyhedrovirus|Rep: Uncharacterized 42.5 kDa protein - Orgyia pseudotsugata multicapsid polyhedrosis virus (OpMNPV)
Ontology
Orthologue
Sequence
(Nucleotide)
AAGAAACCGATCAAGTTAGACCTCTGTGCCTCGGTGAAATTAACGCCTTTCAAACCGATG
CGGCCGCCCAAGCCGATGCAATGCTGGATACATCCTCGACGAGCGAATTGCAAAGTAACG
CGTCCACGTAACAATTATTCAGATCCCGATAACGAAAACGACATGTTGCACATGACCGTG
TTAAACAGCGTGTTTTTAAACGAGCACGCAAAATTGTATTATCGGCACTTGTTGCGCAAC
GATCAAGCCGAGGCAGAAAAACAATTCTCAACGCCGACGACGTGTACGAGTGCGTGTTAA
TTAAACCAATTCGTACGGAACATTTTAGAAGCGTCGACGAGGCTGGCGAACACAACATGG
GCGTTTTAAAGATCATCATCGATACGGTCATCAAGTACATTGGCAAACTGGCCGACGACG
AGTACATTTTGATAGCGGACCGCATGTATGTCGATTTAATTTATTCCGAATTTAGGGCCA
TTATTTTGCCTCAGAGCGCGTACATTATAAAGGAGATTACGCAGAAAGCGATAGTGAAAG
CGGGCAAAGTGTCGACGTTTGTAATGAACTCAAATATCCTTGGAATTTAATTACGGCGAA
CAGTTTTATTGTTTCTACGGACGAGTCGCGTCAGTCGCAATACATTTATCGCACTTTTCT
TTTGTACAATACAGTTTTGACCGCAATTCTCAAACAAAACAATCCATTTAATGTAAT
(717 bp)

- SilkBase 1999-2022 -