SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120028.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P41423 (86%/91)
Cluster: Uncharacterized 38.7 kDa protein in PK1-LEF1 intergenic region; n=5; Nucleopolyhedrovirus|Rep: Uncharacterized 38.7 kDa protein in PK1-LEF1 intergenic region - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
Orthologue
Sequence
(Nucleotide)
GTATAACAAAGGAATTGCTAGACAAATTAAAGCAATGCTATCCTGGTTATGGAATTGGTG
GATGTGGTCCGGTGACAACGACGACGACGACAACGACGCCGCCATCGCCGCCGAAGATCG
GTTCGATCCAGACGACTACAAAAAGTACCACATAAACGTCCAACAATAGTCGCACATCGT
TAAATGGGATTCATTCAAATGCAACACGCACAGTTTCAAGTACAGATACGTGCACAACGA
CACGAACGCAAAATCTACAATGTAATAGATTTTTGCAAAGGTCTTGAAATTGCGCACGAC
GACATACTTGATTGCAATTGGGACAGCGATCAAGTTTACCATTTAAACGAAATTATTTTT
CACAAGCAGAAATCCAAACGCGATCTCAACTCGTTGGGCGCATTGTTCGCGACCAAGCAG
GGGTTGTTGAAAATTTTGATGCGGTTAAATTTTGACAACAAAAGCAACGCGTTGCTGCAC
CTTCAAACTGAAGGCGAGCGTGATGATTGCGCGACAAAATTGAATCTGTTTTAAAACATG
TAAAAAAACTGAATACAAACAGCGAAAAATTTATGGTCACCCACGAAACGTTCAAGAACG
ATGTGGGCAACAGGTTTGAGCAGTTTGAATTGCGTTTGAACGAACTCGACGCCAAACTTA
ACATGCTGCAGTCGGCCGAAAAATTGAAAACCGCCATCGTAACGGAAAGCAAAAATGGCA
C
(721 bp)

- SilkBase 1999-2022 -