SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120027.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P11138 (89%/77)
Cluster: Trans-activating transcriptional regulatory protein; n=11; Nucleopolyhedrovirus|Rep: Trans-activating transcriptional regulatory protein - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0006350 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0005576 C extracellular region
GO:0006030 P chitin metabolic process
GO:0008061 F chitin binding
Orthologue
Sequence
(Nucleotide)
TCCGCATAAAGTGCAAATGTTTTGTGAATCAAATCACGAATTCGACTTGGACTCGGCCAG
CTGCAAGCCTATCGTGTACGATCGCACGGGCAGCGGGTGTGCGGCTCGCATGTATAGAAA
CTTGTTATTATGAAGAGTGGCTTTCTAGTTGCACAACACTATTATCGATTTGCAGTTCGG
GACATAAATGTTTAAATATATCAATGTCTTTGTGATGCGCGCGACATTTTTTTGCAAGTT
GACATTGGCGGCGAACGATCGTGAACAACCAAACGACTATGACGCAAATTAATTTTAACG
CGTCGTACACCAGTGCTCCGACGCCGTCCCGAGCGTCGTTCGACAACGGCTATTCAGAGT
TTTGTGATAAACAACAGCCCAACGACTATTTGAATTATTATAACAATCCCACGCCGGATG
GAGCCGACACGGTAGTATCTGACAGCGAGACTGCAGCAGCTTCAAACTTTTTGGCAAGCG
TCAATTCGTTAACTGATGATAACGATATATGGAATGTTTGCTCAAGACCACTGATAATCT
CGGAGAAGCAGTTAGTTCTGCTTATTATTCGGAATCCCTTGAGCTGCCTGTTGCGGAGAA
CCATCGCCCAGTTCTGCTTATAATGCGGAATCTTTTGAGCAGTCTGTTGGTGTGAACCAA
CCATCGGCAGCTGGAACTAAACGGAAGCTGGACGAATACTTGGACGATTCACAAAGTGTG
GTGGGCCAATTTTAACAAGAATAAATTGAAGCCTAAATACAAAAAAGCACAATT
(774 bp)

- SilkBase 1999-2022 -