SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120026.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P11042 (94%/86)
Cluster: Early 39 kDa protein; n=5; Nucleopolyhedrovirus|Rep: Early 39 kDa protein - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
Orthologue
Sequence
(Nucleotide)
TTTCACAGTAATTACCGACAAATGTTCTAAGCGTAAGGTGTGTCTTCATCACAAACGAAT
TGCCAGGCTGTTGGGCATTAAAAAAATATATCATCAAGAATACAAGCGGGTCGTTTCAAA
GGTTTACAAAAATCAAACATGGTAAACATGCCGGAGCAACAATCTTCTACAGAAACTGCG
GCCGTGTGCAAAAATGAAAAGTTGTTGAATAAACTGGAATCGAGCTCTTACAACAAATCC
AACATGGACCAGCTATTGCTATTGTAAATTTCTTGGAAAAAAAGAACATTAACTATATCC
TCAACGTAATGCCTGTCATGCAGGACGAACGCAAAATGTCCAAACGCAAGAAGAAGGTGA
TTAACAACAATAAATACATTTTGTTTAACAGTTGGTACACTAAGATCAAGCAGCCCGAGT
GGCCTAGTAGCCCGGCCATGTGGGATTTGGTGAAAAACACGCCCGAATTGGCAGATTTTG
TGTTCATTTTTGATCACACTGAAAAGATGGTAAAAAAATGGCCGACCGATCGACATCGTC
GTCTTCAAGCGACAACGCAGCAATTCCAGCGAGCAAAAAAAGACAGACTGCGGTGCTTAC
CAACGCAAATTTGGCAGAATTAAAAGAGAGCTGCGAAATGCGCGATAAGCTTTATTCGGA
GTTTTACAGCTTGTTAAACGAGACATTCAATAACAATGTTGCGCCTCTGCTGAGTAGCAT
TTACGACGA
(729 bp)

- SilkBase 1999-2022 -