SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120024.Seq
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_P10768 (51%/104)
Cluster: S-formylglutathione hydrolase; n=136; cellular organisms|Rep: S-formylglutathione hydrolase - Homo sapiens (Human)
Ontology
GO:0004091 F carboxylic ester hydrolase activity
GO:0005737 C cytoplasm
GO:0008150 P biological_process
GO:0016023 C cytoplasmic vesicle
GO:0016787 F hydrolase activity
Orthologue
Sequence
(Nucleotide)
GGCAGACGGAAATTAGTGCCGTGGTAAATAGTGGTTACAAGATAATTGTGAATATAATTT
TTCCGGAGCTCATCAGAAATCAAACATGGACAGCTTGCAATTAGAATCGTCCAATAAAAT
TTTTGGTGGTTATCAAAAAGTGTATTCTCATGCATCATCTGAATTAAAATGCAAAATGAA
TTTTTCTATCTATCTCCCCCCTCAGGCAGAAGGGGGTGATGTGAAATTACCACTTCTATA
TTATTTGTCTGGTCAACTTGTAGTGAACAAAACTTCATCACTAAATCTGGTTTCCAGAGG
TATGCAGCCGAACATGGTGTAATTGTCGTAGGTCCTGATACTTCGCCACGTGGAGTTAAG
ATTGATGGAGATGATTCATCATGGGATTTTGGAGTTAGTGCCGGTTTTTATTTAGACGCC
ACAAATGAACCATGGAATAATAATTACAGAATGGGCAGTTATTTGAATGTTGAATTATAT
GATTTAATTTTGAAGGCTTTTTGCAATGGGTAGATCCTAATAGAATTGGTATTATGGGAC
ACAGCATGGGAGGGCATGGTGCTTTAGTTTCTACTCTGAGGAATCCTGGCCAGTACAAGT
CAGTAAGCGCTTTTGCTGCTATTTGTAATCCAAGTGCTTGTCCATGGGGAGTGAAGGCTT
TTAGTGGATATTTGGGAGAAGATAAGAGTAAATGGGCGGAATGGGATGCCACAGAGCTGG
TTAAGAAATACAATGGACCTCCTCTTACACTACTACTAGATCGGGAATTG
(770 bp)

- SilkBase 1999-2022 -