SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120021.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_O10372 (72%/62)
Cluster: Occlusion-derived virus envelope protein E27; n=12; Nucleopolyhedrovirus|Rep: Occlusion-derived virus envelope protein E27 - Orgyia pseudotsugata multicapsid polyhedrosis virus (OpMNPV)
Ontology
GO:0019031 C viral envelope
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTTTTTTTTTTATATTATTTAATTATTTATTAAAATTATATATATTAAAGCC
TGATGTTACAGAATTTGAATTTATTTTGTCAAAATCTTCAATGGTAAATTTGAATTTGCT
TAACAGTAAATTAGACGTTTTTGTGCTCATTGTCGATCGCAATTTGTTGGTAAAAAGCGA
ATGGTCCGTTAGCGACTTGCAATATTCAAACACCCCGTAATTTTTAAAAATATAATAATG
CAAATAGGCATGTTGACGATCAGCAACAGAGTTAGATATTGAGTGGCTTCAACCTCAGTT
ATGCTAAAATCGCTCAAATCCATATCGTAATCTGGTTGTTTATTTGACTCGTAATCATCG
CTGCGCGTCGTGTTTTTGCGCTTAGAGGCGCCAAACGTCTTGGCTATCCGCACGTTGCAG
TTATCGTTTTCAAAGTTTACTAAAGCCTCGGTGTCAAACTCGCGGCTTAGCATTTTAACG
ATAGACGGTCTGTCGACGGAGCACAACACACCCCCTCGTTTTCTGTAAACAAAATGGGTT
CTCCGGGAATGCTTGTGTCATTAGTTTCAGTGACCACAAACTCCATTTTGTTAGTAAAAT
TAGTAACAAGTGGATGGAATCTATTGTGTATAAAAGCTAATGTGCTAAACACCACGGCGG
CAATTTGCCGAGTGTCTGCCTTG
(683 bp)

- SilkBase 1999-2022 -