SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120019.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P41435 (79%/114)
Cluster: Apoptosis inhibitor 1; n=13; Nucleopolyhedrovirus|Rep: Apoptosis inhibitor 1 - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0006915 P apoptotic process
GO:0006916 P negative regulation of apoptotic process
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
CCGAGACAAAAACTAAACTGGGCCATATAAACGTGTCGCTAAACCAAAACGACCCAAACG
TGCTCATTTTAACCGTAACTTTAACGAGTTAAAATGAACGAGGACACTCCTCCGTTTTAT
TTTATCAACACGCGCGACAACTTTCGCGACAACATCGCCGAACACGTATTCGACATGTTA
CTAGAAAGACATGGCTCGTTTGAAAATTATCCCATTGTAAACACGGCGTTAATCAACAGC
TTGATCGTTAACGGTTTAAATACAATCAAGTCGACGATCACGTTGTGTGCGAGTATTGTG
AAGCAGAAATAAAAAATTGGTCCGAAGACGAGTGTATTGAATATGCACACGTAACCTTGT
CGCCGTATTGCGCGTATGCCAACAAGATTGCTGAGCACGAATCGTTTGGCGACAACATTA
CCATCAACGCTGTACTAGTAAAAGAAGGCAGACCCAAGTGTGTGTACAGATGCATGTCCA
ATTTACAGTCGCGTATGGATACGTTTGTAATTTTTGGCCTGCCGCATTGCGTGACATGAT
TACGAACATTGCGGAAGCGGGACTTTTTTACACGGGTCGCGGAGACGAAACTGTATGTTT
CTTTTGCGATTGTTGCGTACGTGATTGGCATATTAACGAAGACGCCTGGCAGCGACACGC
CACCGAAAACCCGCAATGTTATTTTGTATTGTCGGTGAAAGGTAAAGAGTTTTGTCAAAA
CGCAATTACTGCCACTCACGTTGATAAACGTGACGACGACGAGACGACGACAACAATTTA
AACGAGAACGTCGACGACGACATT
(804 bp)

- SilkBase 1999-2022 -