SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120018.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P41447 (92%/90)
Cluster: Probable global transactivator; n=11; Nucleopolyhedrovirus|Rep: Probable global transactivator - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0004386 F helicase activity
GO:0005524 F ATP binding
Orthologue
Sequence
(Nucleotide)
GCGCTTTGACCGCAACGAACCGATGGTGCATCACCGGCACACCGATCCACAACAAACACT
GGGATATGTACTCGATGATTAATTTTTTGCAATGTCGTCCTTTTAACGATCCAAGAGTGT
GGAAAATGTTAAATAAAAACAACGACTCTACAAATCGCATAAAGAGTATTATTAAAAAAA
TTGTTTTAAAACGCGACAAATCTGAAATTTCTTTTAACATTCCTAAACACACGGTCGAGT
ATGTACATGTTAATTTAATGAAGAAGAAAAAACGTTGTACGATAAGTTAAAATGTGAATC
GGAAGAGGCGTATATGAAAGCTGTGGCAGCGCGTGAAAGCGAAAACACGCTAAGCCGATT
GCAGCAAATGCAGCACGTGTTATGGCTAATACTGAAATTGAGGCAAATCTGCTGCCACCC
GTATTTGGCCATGCACGGTAGAAATCTTTTGGAAACAAACGACTGTTTTAAAATGGATTA
TATGAGCAGCAAGTGCAAACGAGTGCTCATTTAGTAGACGACATTTTGAACACGAGCGAC
GACAAGATAATATTGGTTTCGCAATGGGTGGAATATTTAAAAATATTTGAAAACTTTTTT
AAACAAAAAAACATTGCTACGTTAATGTACACGGGCCAATTAAAAGTGGAAGACAGGATT
TTGGCCGAGACGACATTCAATAATGCTGCCGATACTCAACATCGAATTTTGCTGCTTTCA
ATTAAGTGCGGCGGCGTCGGGTTAAACTTAATAGGCGGAAACACATTGTAATGCTGGAGC
CTCATTGGA
(789 bp)

- SilkBase 1999-2022 -