SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120017.Seq
JBrowse
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_P32651 (93%/86)
Cluster: Structural glycoprotein gp41; n=34; Nucleopolyhedrovirus|Rep: Structural glycoprotein gp41 - Autographa californica nuclear polyhedrosis virus (AcMNPV)
Ontology
GO:0005198 F structural molecule activity
GO:0019012 C virion component
Orthologue
Sequence
(Nucleotide)
AGTATGACAGATGAACGTGGCAATTTTTATTACAACACCCCTCCGCCGCCGCTGAGGTAT
CCCTCTAATCCGGCAACGGCCATATTCACCAACGCGCAAACTTACAACAACGCGCCAGGG
TACGTGCCGCCTACGACGCGCGACAACAAAATGGACACGAGCCGCAGCAACAGCACAAAC
TCGGTAGCGATCGCACCGTACAACAAGAGCAAAGAACCGACGCTCGACGCCGGCGAATCT
ATTTGGTACAACAATGTGTGGATTTTGTTCAAAAAATTATTAGATATTACAGGTGCAATG
ACATGTCAGAACTTAGTCCTCTCATGATTCATTTTATAAACACTATTCGTGACATGTGCA
TCGACACGAACCCGATCAACGTAAACGTGGTAAAGCGGTTTGAATCGGAGGAGACCATGA
TACGCCACCTGATTCGGTTGCAAAAAGAGTTGGGACAAGGCAACGCGGCCGAGTCCCTGC
CGAGCGATTCGAATATATTTCAGGCATCTTTGTGCTAAATTCGCTGCCGGCGTACGCGCA
AAAATTTTACAACGGTGGCGCTGATATGTTGGGTAAAGACGCTTTGGCCGAGGCGGGCAA
ACAACTCAGCTTGGCCGTCCAGTACATGGTGGCGGAATCGGTGACGTGCAACATTCCCAT
TCCGTTACCGTTCAATCAGCAGCTGGCCAACAATTACATGACTCTGTTGCTCAAGCACGC
CACTCTGCCGC
(731 bp)

- SilkBase 1999-2022 -