SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120016.Seq
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf21180_contig66390
659 bp
UniRef
UniRef50_Q4SV63 (47%/85)
Cluster: Chromosome undetermined SCAF13786, whole genome shotgun sequence; n=20; Tetraodontidae|Rep: Chromosome undetermined SCAF13786, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0003723 F RNA binding
GO:0003964 F RNA-directed DNA polymerase activity
GO:0004190 F aspartic-type endopeptidase activity
Orthologue
Sequence
(Nucleotide)
GTACCATCGACCTCGTTAAGGCATATCAGCAAATTCCTGTTGCGCCTGAGGATATCTGTA
AAACCGCCATCATAACACCCTTCGGACTCTACGAATTTAATTACATGACTTTTGGTCTAC
GCAACGCAGGCCAAACGTTTCAAAGATTTATAGACGAAGCTACGATTTTTGCTTTGCGTA
CGTTGACGACATATTAGTGTATTCCCGTGATGCTCTTCAACATGCTGCACACCTTCGTAC
TCTTTTCAAGCGATTGAAGATTACGGAATCGTTATTAATCCAGCAAAATGCGTGTTTGGT
GCTCCTGAGGTTACTTTTCTCGGAAACAGAATATCCGCCGACGGAACACAACCACCATCA
GAGCGCATTCAAGCTCTAAAAGATTTTCCTCTACCACAGACTGTACAAGGACTCCGTCGT
TTCATTGGGATGGTTAATTATTATCGCCGATTTCTGCGCAATGCGGCCAAGTTACAAGCA
CCGCTAGTCAACGCGATCGTGGCCACTGAGGTAAAGGTCTCACACCGATCACTTGGACAC
CTGAGCTCGAAGAATGCTTTAATGCCTGTAAAGATAGCTTGTCATCTGCAGCTCTGGTGG
CACACCCTTTGCCTAACGCTGAACTAGGGCTTTTCACCGACGCTTCCAGTTCTCACGTTG
GTGCCTGCTTCAACAGAA
(678 bp)

- SilkBase 1999-2022 -