SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120008.Seq
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf16
6248677 bp
UniRef
UniRef50_P19109 (88%/84)
Cluster: ATP-dependent RNA helicase p62; n=9; Eukaryota|Rep: ATP-dependent RNA helicase p62 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0000166 F nucleotide binding
GO:0000381 P regulation of alternative mRNA splicing, via spliceosome
GO:0003676 F nucleic acid binding
GO:0003723 F RNA binding
GO:0004386 F helicase activity
Orthologue
Sequence
(Nucleotide)
CGGGTTCCGGCAAAACGTTGGCCTACATCTTGCCAGCCATTGTGCACATAAACAACCAAC
CGCCTATTCGGAGAGGTGATGGTCCGATTGCTTTGGTCTTGGCGCCTACCAGAGAGTTAG
CACAACAAATTCAGCAAGTTGCTGCAGATTTTGGACACACATCTTATGTTCGTAACACGT
GTGTGTTTGGTGGTGCTCCTAAAAGAGAGCAAGCCCGGGACTTGGAGAGGGGAGTAGAAA
TAGTCATTGCTACTCAGGTAGATTAATTGATTTCTTGGAAAAGGGCACAACCAACTTACA
GCGGTGCACATATTTAGTTCTTGATGAGGCTGATCGTATGTTGGATATGGGATTTGAACC
ACAAATCAGAAAAATCATTGAGCAAATACGCCCAGACAGACAGACTTTGATGTGGTCAGC
TACTTGGCCCAAAGAAGTGAAGAAACTTGCTGAGGATTACTTGGGAGATTACATTCAGAT
CAATATAGGATCATTACAACTTTCCGCAATCACAACATTCTTCAAATTGTAGATATTTGT
CAAGAACATGAAAAAGAAAATAAATTAAATGTATTATTGCAAGAAATTGGACAAAGTCAA
GAACCTGGTGCAAAAACAATAATTTTTGTTGAAACCAAGAGAAAGCTGAGAACATATCAA
GGAACATAAGGAGATATGGCT
(681 bp)

- SilkBase 1999-2022 -