SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120007.Seq
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_UPI00005863FB (46%/32)
Cluster: PREDICTED: hypothetical protein, partial; n=1; Strongylocentrotus purpuratus|Rep: PREDICTED: hypothetical protein, partial - Strongylocentrotus purpuratus
Ontology
GO:0005216 F ion channel activity
GO:0006810 P transport
GO:0006811 P ion transport
GO:0016020 C membrane
GO:0016021 C integral component of membrane
Orthologue
Sequence
(Nucleotide)
GGTACATCGTTGCCTCGATTTTTGGCACGGTGCTCGGTATAGCCGGTTCGACGATAAACA
ATCACCTGAAGATGGCCGAGTTCAGGGACATGATGGAGCAGCAGATGGCCCGGAGCGCGA
GCGTCCTGTACACCATCGCGGGGGGCGGGACCGCCAGCCGGGCCGACATCACGGAGGCGA
TGAAGACCGAGTTCGCTTACCAGGAACAACTAGCCCAAAATTTGAAGTTGATGCAGGAGA
ATATAAATCATCTTTCAGCAAGCAAACTTCCCTTATCGAACACATGCACAATCAGGAGCA
TTTAGTCGAAACTCAAATGAAGGATCTCAAACGATTGATAGTCACCGCCTCGCAGTCGAG
CGCCAAGTCGGACGCGGAAATAGCGAAGGCCCTCTCAGTCGTGCACCAAGATCTCGACGA
GGCTGACAAGGACCGCGACCTGGAACCGGCCAAGGTGTCGCTGGAACCAAATCAAATCCT
AACAGGCATCGGCATAATAGTGTGCTTCCGATAATATTCGGCAACATTCTGGGCAGAGTC
AGTTGAGATGTCAATATTCAGCCCGGACTCGGGAAGTTTGATTTTGGAATCCGGTCACAT
TTTTTATTTATTTATTTCGATAAACGGTTTGCTTTTTAAGTCTTTATACCTTAGTGTAAA
C
(661 bp)

- SilkBase 1999-2022 -