SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameNV120002.Seq
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf13
6731059 bp
UniRef
UniRef50_Q9VIF0 (67%/37)
Cluster: Nucleolar complex protein 2 homolog; n=2; Sophophora|Rep: Nucleolar complex protein 2 homolog - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
CTTAAGTGTCTCCCGGGCAAAGAGAAGAACCTTGAATTTACGACAAGTTTTGGTACTTGT
ATACCTTTACGGCTTCGAATACAAAATAAAACCGATGTGAAAACAGATTTCATAGCTGAG
GTATCTCATTCTTCAATTCAAATAGATAAAGAATGTTGCTTGGGACCATTAGAAAAAGGA
AAGATTTTAGTGTGGTTTGAACCAACACAGTTGGGAGTGCAGAATTGTAAAGTGTCCTTC
AAATCGACGCTCGCGGTGAATTTATTTAATATTAAAGGAATAGCGACGGAACCCAAGCCG
CAGGCCCGTACGAAGTTAAGGCTGGTGGATCTACAACTATTAAATTTAAAAATGTCTTCG
ATTCATCGAGAATGTTCAAAATATACGTAGACCGGGAGGAGTTTTACGTTAAAACTATGT
TTGAAACTATAAAACCAAAGAAGGACCTGAGAATATCTGTTTATCTGAACGACAAGCCCG
CACAAGGCTGGACAGAAGTACCTACTGGTGTTTAACTATAGAGACACACGAACCAGCTGA
ACCTAAAGTACACTGGACTTATTTTCTACAGGGAAAACAGTAGATTCAAAACAACTGGAT
CTAGAAGAAGTGCTTGTTGGTTCCTGGTTATTCTTAAAATGCAGAGAAAAGCTAACACTC
TCACAGTTTCTTCACTAGTGCTCCACAGTAAAATAAGTTTTCTTAATGCCATTTTAGCAA
TTCTT
(725 bp)

- SilkBase 1999-2022 -