| Name | I10A02NGRL0007_K04 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_Q8C1T8 (44%/38) |
| Cluster: Adult male intestinal mucosa cDNA, RIKEN full-length enriched library, clone:G630065F06 product:C-type lectin related f, full insert sequence; n=22; Euarchontoglires|Rep: Adult male intestinal mucosa cDNA, RIKEN full-length enriched library, clone:G630065F06 product:C-type lectin related f, full insert sequence - Mus musculus (Mouse) |
|
| Ontology |
| GO:0005529 |
F |
carbohydrate binding |
| GO:0005887 |
C |
integral component of plasma membrane |
| GO:0006968 |
P |
cellular defense response |
| GO:0016020 |
C |
membrane |
| GO:0016021 |
C |
integral component of membrane |
|
| Orthologue |
|
Sequence (Nucleotide) | cgcatctatcatgaaactattcaagatactcggttgcatcatgtctctaatggtggcagc
tcgagcatggtcagagctgctgaaacggaggaagaaggttccagccctaaaggaccaggt
catgccgaagaatcttc
(137 bp) |