Name | I10A02NGRL0005_M22 |
JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
UniRef |
UniRef50_UPI0000D56533 (36%/77) |
Cluster: PREDICTED: similar to Inter-alpha-trypsin inhibitor heavy chain H4 precursor (ITI heavy chain H4) (Inter-alpha-inhibitor heavy chain 4) (Inter-alpha-trypsin inhibitor family heavy chain-related protein) (IHRP) (Plasma kallikrein sensitive glycoprotein 120) (P...; n=5; Tribolium castaneum|Rep: PREDICTED: similar to Inter-alpha-trypsin inhibitor heavy chain H4 precursor (ITI heavy chain H4) (Inter-alpha-inhibitor heavy chain 4) (Inter-alpha-trypsin inhibitor family heavy chain-related protein) (IHRP) (Plasma kallikrein sensitive glycoprotein 120) (P... - Tribolium castaneum |
|
Ontology |
GO:0004198 |
F |
calcium-dependent cysteine-type endopeptidase activity |
GO:0005622 |
C |
intracellular anatomical structure |
GO:0006508 |
P |
proteolysis |
|
Orthologue |
|
Sequence (Nucleotide) | gttgaaagaagctatgtatactatattaaatgaactgaaccccggcgactactttagcat
cattgacttagaatcaattattacggtccacgaactgtccgaagccgataaggaaaaaac
aaggtataaatacttttattacaacgaaattcaaccaaagttggatttagttgcaccgta
tcaagccacaccggagaatattgagaaggctaaaattatcatcagtagtcgtttcttcgt
tcacctgatcagactgataaacaaagttgacgtgagcgagc
(281 bp) |