SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NameF1mgP01A07f
JBrowseBomo_Scaf089
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
(no hit)
Ontology
Orthologue
Sequence
(Nucleotide)
AGAGAGAGAGAACTAGTCTTGAGTTTTTTTTTTTTTTTTTTGTTAATGAAATTATTTTAT
TATTGAATCATTGNTCATTCGTCAGTTAAATTCTAGCCCGGATCCAGGAGTTGAAGGATG
TGACTCTGGCGAAGCCGGCAGGGTGGCCTCTCTGGCAACCTTGAGCTGATCCGAACGATG
TGATACCGATCAGTTGACGGCTTCCGCCGCTGCCGATGGTGAGAGGGCCGCCGNAGTCTC
CGCTGCAGGTGCTGCGACCGTTAGAGCCGTCAACACAGAGGGTGGAGGCAATGATCACAT
TGTTTCCAAACGTGCGGCCGCAGACGGCGTTGGTAATGACCTGGAGGCTCACTTGGCGTT
TTTGTTGGTTGTTGGCTCCCGAAGCAGCATCGGAGGTCCTTCCGAAGCCGGCAGCCCAGG
CCCAAGTACCAGCAAAGTTGTTGCTTCCACTGGCTAGGTTGATGCGCTGGATGTTGTTGG
TGAAGCCAACATGGTTGTGGTTGATGATGGCGACGTCGTTGTGGAGGGTGTCCATGTTGT
AGCTGCCGTGCATCTGGACATTGGAGGTGGTGACCCTGGTGCCTCCGGAGAANNTGTTAG
CTGTGCCAAGAGCGAGGGTGAACT
(624 bp)

- SilkBase 1999-2022 -