SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30060
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_Q6PTI2 (60%/107)
Cluster: Fructose-bisphosphate aldolase; n=1; Modiolus americanus|Rep: Fructose-bisphosphate aldolase - Modiolus americanus (American horsemussel)
Ontology
GO:0003824 F catalytic activity
GO:0004332 F fructose-bisphosphate aldolase activity
GO:0006096 P glycolysis
GO:0008152 P metabolic process
GO:0016829 F lyase activity
Orthologue
Sequence
(Nucleotide)
CCGAAACAGTGCTAGTCTTTCGTGTTGTAATTAATACAAGAATAAAAAAATAATCAACAA
TGTCCACCTACTTTCAATACCCAACTCCTGAGCTGCAGGAGGAGCTCAAGAAGATCGCTC
AAGCAATTGTAGCTCCCGCAAAGGGTATCCTCGCCGCTGACGAATCCACCGGTACAATGG
GAAAGCGTTTGCAGGACATCGGCGTGGAGAACACAGAGGAGAACCGTCGTCGTTATCGCC
AACTCCTATTCAGCCTGACGCTGTGCTCTCCGAGAACATCTCTGGTGTGATCCTGTTCCA
CGAGACCCTTTACCAGAAGGCTGACGATGGAACGCCTCTGGTCTCCCTGCTGGAGAAGAA
GGGCATCATCCCCGGCATCAAGGTCGACAAGGGTGTCGTCCCGCTGTTCGGATCGGAAGA
CGAATGCACCACCCAGGGTCTGGACGACCTCGCCCAGCGCTGCGCCCAGTACAAGAAGGA
CGGCTGCCACTTCGCCAAGTGGCGTTGCTGCTGAAGATCGGCCGCAACACCCCCTCGTAC
CAAGCTATCCAGGAAAACGCCAATGTTTCTCGCCCGCTTACGCTTCCATCTGTCAGAGCC
AACGCATTCGTGCCGATTGTTGAAGCCCGAAGTCTTTACCTGATGGGCGAAGCACGAACC
TTGGAACCGCGCCCCAGAAAGGTTAACTTAAAGGTCGTTCTGGGCCGGCCGGTTTTAAAA
AGGCCCCTTAAACGGACCACCAAGTTTTTACCTCCGAGGGGGAAATTCCTTAAAGCCCAA
AATTGGTTAAACGGCCCGGTAAATTTTTCCAAAAAAAGGGGTTA
(824 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).