SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30055
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf36
4352778 bp
UniRef
UniRef50_Q9VUR4 (52%/116)
Cluster: Ubiquitin carrier protein; n=7; Eukaryota|Rep: Ubiquitin carrier protein - Drosophila melanogaster (Fruit fly)
Ontology
GO:0006464 P protein modification process
GO:0006512 P ubiquitin cycle
GO:0016874 F ligase activity
GO:0019787 F small conjugating protein ligase activity
GO:0004842 F ubiquitin-protein ligase activity
Orthologue
Sequence
(Nucleotide)
CTGTAGCACGCACGTAGCTGATTTTCTTCGGATTACGTTTCGTTGAACGGTGCTTCGCTT
TCTCATTGTTGTTTAACTGATCGTGTGCTTTGGGTCTATTGTTTCGTCTACTTTTCAACG
TAAATTATTAACAAAGATTTAAGGGTTGACGTTTGAAGTGTGTGACACGTACTTGTGGAT
GCTGCAGTATCGATGCTATGTTTACCAAAATTTCTAGTTCGTTGTTATTGTGACGAGTTG
AAATGCCTGGTGGAACGTGGACAGCATAAAGAGTTCCAAAGTGATATGTTTATATAATTT
TGTTTAGATAGGTAGTGAAGGTTGAATAAATACATAACTGACAATGTCTAACACTGTTCC
AACGAGTTCAGCCCTCAGGGCTTTAGCGTTGGAGTACAAGAGTCTGCAAGAAGAACCTGT
AGAAGGTTTCCGTGTTAAATTGCTAGGAGAGGACAATCTATTTGAGTGGGAAGTGGCAAT
CTTCGGACCGCCGGATACACTTTATCAAGTGGATACTTCAAGGCACACATGAAATTCCCC
CCTGACTACCCGTATTCACCACCATCCATTAGGGTTTTTAACTAAAGTCTGGGCATCCAA
ATGTATATGAAAACGGAGATCTTTGCATATCGATTCTCCACCCGCCCGTGGGATGATCCT
CAGTCTGGCGAACTGCCCCTGCGAACGTTGGGAACCCTACACAATCGGTTCGCAACCGGT
ACTCCCCCTCTGGTAATCTCAATCCCTCAAAGGAGCCCGAACACCTTTCAGTTCCGGGGG
AACGGTCGATGCCAACGGTGATT
(803 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).