SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30049
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf13
6731059 bp
UniRef
UniRef50_Q4T4A9 (80%/62)
Cluster: Chromosome undetermined SCAF9757, whole genome shotgun sequence; n=2; Euteleostomi|Rep: Chromosome undetermined SCAF9757, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0003676 F nucleic acid binding
GO:0004386 F helicase activity
GO:0005524 F ATP binding
GO:0008026 F ATP-dependent helicase activity
GO:0016787 F hydrolase activity
Orthologue
Sequence
(Nucleotide)
GCCAGAGGATTCCAAAAATGGGCCATCGAAGGATCAAGGTAGTTACGATGGACCTCCGGG
AATGGACCCTGGGACACTTGCACACCGACTGGGATCAAGTTGTCGAAACCTTCGATGACA
TGAACCTCAAAGAAGAATTGTTGAGAGGCATATACGCCTATGGTTTTGAAAAACCTTCTG
CAATCCAGCAACGCGCAATAATGCCTTGCATCCAAGGACGCGATGTTATCGCTCAAGCCC
AGTCAGGAACTGGAAAACTGCTACTTTCTCTATATCGATTCTACAACAAATCGATACAAG
CATTCGTGAATGTCAAGCTTTGATCCTGGCTCCCACAAGAGAGCTGGCCCAACAAATTCA
GAAGGTGGTGATAGCTCTTGGTGATCACTTGAATGCTAAATGCCATGCTTGCATTGGTGG
CACCAATGTCCGTGAAGATATTCGCCAACTGGAGAGTGGTGTTCATGTACGTGGTGGGCA
CTCCAGGGTCGTGTATATGATATGATAATCGTCGTGCGCTTTCATGCCAACACCATCAAA
CTTTTTGTTCTTGATGAAGCTGATGAAAATGTTGTTCCAGAGGTTTTCAAGGGACCAGAT
CCATTGATGGTCTTCAAGATGGTTGGTCAGCTGATTGTTTCAAGTCAATATTTACTCTCC
TGCTAACCATGGCCTGGATTGAATGTTATTTGGGGAGTTATCGCCGATGGCTTTTATGTG
TAGATCC
(727 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).