SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30041
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
chromo24
Bm_scaf107
1152854 bp
UniRef
UniRef50_Q0YFQ3 (37%/37)
Cluster: Twin-arginine translocation pathway signal precursor; n=4; Geobacter|Rep: Twin-arginine translocation pathway signal precursor - Geobacter sp. FRC-32
Ontology
GO:0005506 F iron ion binding
GO:0006118 P electron transport
GO:0009055 F electron carrier activity
GO:0046872 F metal ion binding
GO:0051536 F iron-sulfur cluster binding
Orthologue
Sequence
(Nucleotide)
CGACGAGTCAATCTTTGGGAATGGACAAGGGGTATAAGCTTGGCTCTACGCATTCGCATG
TACCGATTTTCGATTGTGCAATTATAGAGTTTGGAGGGTATTTAATAATAATTATTATTA
GGTTAGGGGTCTAATACAGAAGGCAATTATCCTCGATACTGCGCGTATTGTAAGGAAGTT
TTACACTCTGGAGTCCTAACCACTGGTGGCTTGTATCGTAGACACCGCCATCAGCGGCAA
TCTATTTTTATATATGTTTTCTAAAAGTTGTATTATTAATAATATCTTTTTAAAAAAACG
TGTATAATTCATAAGATTTTAAATAAGTATAGACTATGTTAATAATTAAAATTGTTAGGA
GCAGCCAAATCAGTCTACCCTCTTTTTTATCCGTTTTCTGTATGGAAGGGAAGTAAGGAG
CGCCATTTCAAAGTATTAAAATTGTCCCCTGAAAGGAGTCAATTAAGGTGGCGCCATAGT
ACAATAATTATATGGAATACCATAGTAGAATAATAGATGGATTGCGTGAAACACTATATT
ATTGAGATTATGTTGATAAACAAGAATTCTTTGAACTATACGTTTTATTTTTATAAATAA
ATTCACACACGTTTACACACCGCATACAAGATGGCAAGATGGAAGGATTTACAAAAATGG
CGCCATCTGGCGTTACACTATAAATAAGACCAGAGCATACAGCCTAAAATTCATAAAATT
TTATCCGATATATACGTGTCAGATGGG
(747 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).