SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30029
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf192
108803 bp
UniRef
UniRef50_UPI00015A487B (30%/75)
Cluster: UPI00015A487B related cluster; n=2; Danio rerio|Rep: UPI00015A487B UniRef100 entry - Danio rerio
Ontology
GO:0016740 F transferase activity
Orthologue
Sequence
(Nucleotide)
GTCTGATCAGCGCCCCTGGCGGCAAACGCAGCAAACGTTCCAACTCCATACAAAATCGAG
TTAACTTTTACGCTAACGAGAGCGTTAAAAAAACTCGCACTAAGCGCACTGTATACGGGC
AGCCTGGCCCGAGTACCTGTGCTTATATCGCCGGGTCCAAACAACGAGATATAAAATTAT
ATTTTACAAGTTTAATTTATCGCTAAATAATATTATGGTCGAGGGTGTTCTTCCTCCAGT
CAATTAACACGCATTATGTCGCTTACTGTACGCTATATCCGAAATACCTTTACGCTTGTA
TCCCGTTTTTAAAAGAATTTTTATGACGGTATTTTTTAATTCTGTACACTTTTGTGCATG
TGCAACTATCAATTGGCCATAATTTGTAAAAGTTTCCGACGCTCCTTTAAGCAAAGATGA
GCACTTTGTACAATAACTCTGTCAAATTAATGCGATTGGTTAACTTAAACAAGAGAAAAG
GTAAGTTTGTCGTTTCTAACAAATTTGTCTATTGATGAGTGCACATTCAC
(530 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).