SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30027
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf13
6731059 bp
UniRef
UniRef50_P38919 (48%/214)
Cluster: Eukaryotic initiation factor 4A-III; n=366; root|Rep: Eukaryotic initiation factor 4A-III - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0000184 P mRNA catabolic process, nonsense-mediated decay
GO:0003676 F nucleic acid binding
GO:0003723 F RNA binding
GO:0004386 F helicase activity
Orthologue
Sequence
(Nucleotide)
GGAAAAACTGCTACTTTCTCTATATCGATTCTACAACAAATCGATACAAGCATTCGTGAA
TGTCAAGCTTTGATCCTGGCTCCCACAAGAGAGCTGGCCCAACAAATTCAGAAGGTGGTG
ATAGCTCTTGGTGATCACTTGAATGCTAAATGCCATGCTTGCATTGGTGGCACCAATGTC
CGTGAAGATATTCGCCAACTGGAGAGTGGTGTTCATGTGGTGGTGGGCACTCCAGGTCGT
GTATATGATATGATACTCGTCGTGCGCTTCATGCCAACACCATCAAACTTTTTGTTCTTG
ATGAAGCTGATGAAATGTTGTCCAGAGGTTTCAAGGACCAGATCCATGATGTCTTCAAGA
TTTTGTCAGCTGATGTTCAAGTCATATTACTCTCTGCTACCATGCCTGATGATGTATTGG
AAGTATCTCGATGCTTTATGAGAGATCCTGTACGCATACTTGTACAGAAGGAAGAGCTTA
CCCTGGAAGGTATTAAACAATTTTACATGCATTGAATTAGAAGAATGGAAGCTGGAAACT
CTGTGTGACCTGTATGATACACTGTCTATTGCACAAGCTGTAATTTTCTGCAACACCCGT
CGCAAGGTGGGATTGGCTCACTGAATCTATGCATCTGCGTGACTTTACTGTATCTGCTAT
GCATGGGAGACATGGATCAACGTGAGCCTGAAGTGATCATGAAGGCAGTTTCGTACTGGC
TCCTTCTCGTGTCTTGATTCACCACTGATTTATGGGCACGTGGTA
(765 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).