SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30025
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_A0CH36 (19%/96)
Cluster: Chromosome undetermined scaffold_18, whole genome shotgun sequence; n=2; Paramecium tetraurelia|Rep: Chromosome undetermined scaffold_18, whole genome shotgun sequence - Paramecium tetraurelia
Ontology
GO:0006508 P proteolysis
GO:0009002 F serine-type D-Ala-D-Ala carboxypeptidase activity
GO:0003678 F DNA helicase activity
GO:0004386 F helicase activity
GO:0019079 P viral genome replication
Orthologue
Sequence
(Nucleotide)
AAACATATTAATGAACCTTTTAAATTTAAGATACAATTTGTAAACACTGCTATTTCAAAT
ATCAAAGCTATTAAAAATCATGAAACTTGGTCCCTCCTAAATACACTCTTTCATAGTATG
GAAGTATATGTTGAATCTGAAAATAATGTGCAAAAATGTATTGAAATTATTATTGTTCAT
AATGTTATGGTTGGTGAAACAAATCAAGAAATTGTAATTAAAAAGTTTTCTTTCAATACA
ATGAAATCGTTTGCAAGATACTAAATCAAGAAGAGAAAACAAAATTGTTTAGTTTTCTAT
ATGATCACTTACAAACACAATTAACTAGTCAAGAAATAAATGATAAAACATCTCTTGTAG
ATAATATTGGAATAATAAAAAATATTCTGATATTAATTAAAGATTGGAAAAAACACATAT
CTGACTTTCCCTTTGTTTGGAATAAAATTCAAGAACTCATGAGAATTAAAAAAGATAACT
CCTGGGATGTAGACTTTTCATTTGTGTAAATTTAAACAAAGCCTGGAGACGACACATGTT
TAAGGAATCTATTGCCCTTTCTCCTAACTGAAATAGTATTTATAAATGCTTGAAACATGA
TTCCAGATTTATTGGTTCTATACGACAATGACATAAGGACTTGTGTGAAAAGGAAACCAT
GTCATTGGAGAATGGTTTCCCCAGTAAATTGGCGTACCATATTGGGCCGGCGAAAATCTT
GGCTATTGGCCTGG
(734 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).