SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30023
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf3314_contig48507
1256 bp
UniRef
UniRef50_Q16RN6 (89%/73)
Cluster: Adp,atp carrier protein; n=1; Aedes aegypti|Rep: Adp,atp carrier protein - Aedes aegypti (Yellowfever mosquito)
Ontology
GO:0005215 F transporter activity
GO:0005488 F binding
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
GO:0006810 P transport
Orthologue
Sequence
(Nucleotide)
ATCATCTCCTATCCCTTCGACACAGTCCGTAGGCGCATGATGATGCAGTCTGGTCGTGCC
AAGAGCGATATCCTGTACAAGAACACCATCCACTGCTGGGCTACCATTGCCAAGACCGAG
GGAACCTCGCCCTTCTTCAAGGGAGCCTTCTCCAACGTCCTCAGAGGTACTGGTGGTGCC
TTCGTGCTCGTCTTGTATGATGAGATCAAGAAGGTCCTGTAAATCTAACGTAAGAATTGT
TACCATAATTTCTAGTGATTCCGTGTCGCAGCCACTCCCCTCAAATCATGTATTATTAGA
CACGAAAACGACTTTAGTAACTTATTTTTAGTTAAATAAAGTGTTATACAATGATTCCAT
AATTTATTGTTTTATTAAGTGTTACATAATTGGTTGTTCTAACTGAAGTGATATAGGACC
TCTTTGAAAATTTTCTAATTTTGACATCTCAATTGCTTTCATATTATATAATCTATTCTT
AATTCAAAATGAAAAATGATTAGTTTTTTTTATGTGACATTACATAGTTTGGGCTGCGGC
TGTTATGTAATTAACCTCATTTCAGTCTGGTGCCGGAGCCAAGGCTGAACTAAAAATTGT
TTAGAACTTCATGTTAAAAGAAGTGTTTAATGTCTTGTCTATTTTAAATTTGAGTTTTGT
GGGAATTGAGAATTTCCACTTTTTCTTACACAGCGGGAGTGAGTTTGACATAATTATGTA
GTGGATTTTTGACTTCTGTACACATTATGCCATTAAATGTAAATCCATGG
(770 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).