SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30014
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_Q96H53 (56%/142)
Cluster: HSPA8 protein; n=37; Eukaryota|Rep: HSPA8 protein - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0005524 F ATP binding
GO:0005515 F protein binding
GO:0005622 C intracellular
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
GCGTAACACTACCATCCCCACTAAACAGACTCAGACATTCACCACCTACTCTGATAACCA
ACCCGGAGTACTCATCCAAGTATTTGAGGGTGAGCGTGCTATGACCAAAGATAACAACTT
GCTCGGTAAATTCGAGCTGACCGGGATCCCACCGGCGCCGCGTGGCGTGCCTCAAATTGA
GGTCACCTTCGACATCGATGCCAACGGTATCCTCAACGTTTCCGCTATCGAGAAGTCCAC
CAACAAGGAGAACAGATCACCATTACCAACGACAAAGGTCGTCTCTCCAAGGAAGAGATC
GAGCGTATGGTTAATGAGGCAGAGAAGTACAGAAACGAGGATGACAAGGCAAAAGGAGAC
CATCCAGGGCCAAGAATGCATTGGAATCTTACTGGCTTCAGCATGAAGTGCTACCATGGA
GGATGAGAAGCTCAAGGAAAAGATTCTCCTGAACTCTGACAAGCAGACCATTCCTCGAAC
AAGTGCAACATCCACCCATTCAAGTGGATGGGATTTCCAGTCCAGGCTGGCCGAGCAAGG
AGGAGTATGAGCACAAGGCAGAAAGAATTGGGAAGGGCATTTAACAATTCCGATAATTAA
CGAAGATTGTA
(611 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).