SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30011
JBrowseBomo_Chr6
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_Q5TTQ2 (72%/85)
Cluster: ENSANGP00000026814; n=3; Endopterygota|Rep: ENSANGP00000026814 - Anopheles gambiae str. PEST
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
Orthologue
Sequence
(Nucleotide)
GGAAAGTAGAGGTGATTAACGAAAGGAAGCTCACGGAATATTTAATACTGCAGAAACAAA
GACTTAGCAAATTAAACTGAAATCCAATTCTTAATTGATTATTAACATCTTAGGACTTAA
GTCTAGTAAATATTAAATATGAAGCCTTCGGAAAGCGGCGATGACTATGAAGAACCTGAA
CACACACGTAAACTTTTTATCGGTGGACTCGACTATAGAACCACAGATTCTTCATTAAAA
GAATTCTATGAGCATGGGGAGAAATTGTAGATGTAGTTGTAATGAAAGACCCAAAAACCA
AGAGATCAAAAGGATTTGGATTTATTACATATTCTCAAGCCCATATGGTTGATGAAGCTC
AAAATAATAGGCCTCACAAAATTGACGGAAGAATTGTCGAGCCAAAACGAGCAGTTCCAA
GGGAAGAGATTAAAAGACCAGAAGCTAGTGCCACCGTTAAAAAGTTGTTTGTAGCTGGAC
TGAAGCAAGACATTGAAGAAGAAGACTTAGAGAGTATTTTAGTACATTTGGAAATATTGT
TTCTGTTAGTGTTGTGACAGATAAAGAAACAGGAAAGAAAAGGGGCTTTGGTTTTGTAGA
GTTTGATGATTATGATCCAGTTGACAGAGTATGCTTGCAACAAAATCACCAAATTAAAAG
ATTCAACATTTGGATGTGAAAAAAGCCAATATCCGAAAACTGACATGTCTGGGCGGGGGT
AATGATTAGAGGAGGTCCGCGGTCGACGCGGGGGGTCCGGCCGTAA
(766 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).