SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30010
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf5
8683647 bp
UniRef
UniRef50_Q8D2I2 (29%/65)
Cluster: YeaZ protein; n=1; Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis|Rep: YeaZ protein - Wigglesworthia glossinidia brevipalpis
Ontology
GO:0004872 F receptor activity
GO:0005515 F protein binding
GO:0007155 P cell adhesion
GO:0007229 P integrin-mediated signaling pathway
GO:0008305 C integrin complex
Orthologue
Sequence
(Nucleotide)
TGCTATTAGGGCATTCGTTTATGAAATACAATAAATATATTATAGTTTGTGCGTCAATGA
TTGAATGGATAATATTTATATATAATTAAGAAATCCTGAATTCATAATTTCAATACTTAA
TTTTGATTATTATATTTGTGTGGGTGCTTAACTGAAGGCGTTTGGTGTTGTAAGATTTAA
AAATACATTATATCAAGTTAACTCACCCGATGTGTGTGACATCCACTTATTACCTATTAT
CAGCTTAAAATCGTTTTTTATTTACAAAAATGGATTTTGCGTGTAGCAAGGCAACTATTA
CCTGCAGTACGGCCTATTTGTCTTAAAAATGATCTCAGAGCCACTTTTAATAGTTCAATG
GCAGAATAGTTAAAATTCGAAATTGAATAATGAAGGTCGGGTCGTTTCGGGTCTGTCCGG
CGCCGGTAGCTGGCCAGTTCGTCGTATAGGATCGCGCGACAATGCCGTCGGAAACACGGG
AAATGGAAAGATAAAGGGGAAAATGAGTAGCTCGGTAGAGAGCAGGTAGTCGGGGTGAGC
AGCAC
(545 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).