SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30005
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_Q9TWZ1 (35%/76)
Cluster: Protein disulphide isomerase isoform/multifunctional endoplasmic reticulum luminal polypeptide; n=8; Endopterygota|Rep: Protein disulphide isomerase isoform/multifunctional endoplasmic reticulum luminal polypeptide - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005783 C endoplasmic reticulum
GO:0016853 F isomerase activity
GO:0045454 P cell redox homeostasis
GO:0003756 F protein disulfide isomerase activity
GO:0004197 F cysteine-type endopeptidase activity
Orthologue
Sequence
(Nucleotide)
CCGAGGCGACGTTCGCAGTCAGCGACAAGGACGACTTCACGCACGCAGCTCAACGAGTTC
GGCATCGACTTCGCTAAAGGCGACAAGCCCGTAGTGGCCGGCCGCGACGCAGACGGCAAA
CAAATTCGTCATGAGACGCGGAGTTCAGCATCGAAAATCTACTAACGTTCACAAAGGACC
TGCTCGATGGGCAAGCTGGAGCCATTCGTGAAATTCCGAGGGCCATAACCGGGAAAACGA
ACGGGCCCAGTGAAGTAGCCGTTCGGCAAGAACTTTCAAGGAAACTGGTTCACGGACAGC
AACAGGGACGCAACTTCATAGAATTTCTATGGCGGCCATGGTGGCGGAACAACTGTCAGA
AGCTTGGCTCCCGTTCTGGGAAGAGCTTGGTGAAAAGTTGAAAGATGGAAGAAGTTGAAC
ATTCATTCAAGATTCGATGCAAACTGGCAAATGGAACTGGGCCCAAATTCACAATTTCGA
ACGTTTTCCGGGCTTTCCCCCCCACAAATCTTTCTGGGAAAGCCCTTAAAGGGAACAGCT
TCCCAAAGAAAAACCCCTTCAGAGATTATTAAATGGGAAGGGAACCGTGGCTTCTTAGAA
GGAACCTTTCATTCAAAGTTATGTTTTCTGGAAACAAAGCCCAACAAAGGCGAAACTTTT
AAAGGGGGGCTTGGGGGAACCAGAAAAAGGGGTAAACGCCCAAAAACCAAAGGGAAAAAG
GGAAAGAAGTTTGTTAGGGCCGTGCCTTGTTTGTTGAATTTTAAAAAACTTTTTCCCATG
GAAAAAAGATTCTTGCCGTTGTTGTTAATTTTTGGTTGTTGAAAGGGATTGAAATTGGTA
AATGTTNGGAAAAAAAACCAATTGNAAAATTTANTTGAACTTTCTTGGAAGTTTTNATGG
TGGTTGTTAAATAAATCCTGGTNCCCAAAGGGGGAAAAAGCCCCGGNTTNTTTGAAAAAA
GCCATTTCTTTTTGGGGGTAC
(981 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).