SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NamewdS30001
JBrowseBomo_Scaf025
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf17043_contig62253
687 bp
UniRef
UniRef50_Q4QQE8 (42%/170)
Cluster: Endonuclease-reverse transcriptase; n=43; Eumetazoa|Rep: Endonuclease-reverse transcriptase - Schistosoma mansoni (Blood fluke)
Ontology
GO:0003723 F RNA binding
GO:0003964 F RNA-directed DNA polymerase activity
GO:0004519 F endonuclease activity
GO:0006278 P RNA-dependent DNA replication
Orthologue
Sequence
(Nucleotide)
TGGCCAGAATATGCGGAGTATCGACCTCAAGCACTTATTTACAAATACCTGCAGCCGGTT
CGTGAGTGTCTTGGTCACTCTCCAGGTTTCACATCCGAAAAGGAGAACACTCTTGACAAT
GGAGTCGAACAGGGTCAGCTTGATCCGACGAGTCATGACACTTGACTCCCAGACTGGTTT
CAACTGCGCGAAAGCACCCCTGGCTTTCCTAATTCGTATCTCTATATCTTCGTCCGAACC
ACCCTGATTTGATAGGAGCTCCCCAGATATGTAAACCTCTGTGCTGACTTCAAACCCACA
GTCTTGGAGCTTTAGGGGAGTAGTGTTTTTTGACATTACTCGCATGTCGACAGTTTTGTT
GGTGTTAATACGCAAGCCTCTTTTCTCCGCAGATATACGGAGGTCTTCAAGTTTTGCTTG
CATTTGATCCAAAGTTGGCGTCATCAACACTATGTCATCTGCATAGTCAAGGTCTTCCAA
GATATTTTCGCTCCATTCAATGCCCCGAGTGTTGTCACCACTTCCCGCATTATGTCATCC
AGTAACATAATGAATAGTAGCGGAGACAGGAGGCAGCCCTGCTTAACACCCGCTGTCATC
TCAATAGGGGCTCCCAGGACTTGGTCATGCACGACTCTACATGTACTACCTCTGTATAAG
GCCTGGATTATACCAATGATTTTATTTGGTATACCTCTTTGTTTTAAGCAGGGTCCACAT
TTTGCTCCACTGTACAGTGTCAAAACGCTTTTCTCAAAAGTCAACAAACGTAAGAATCAT
TTTCAGTCTGCCAATTCGACACTTTGTTCTATGAAGGATGCGAAGAGTGTTTT
(833 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).