SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0034
JBrowseBomo_Chr27
chromosome_No.
Scaffold_id
Scaffold Length
chromo27
Bm_scaf112
959855 bp
UniRef
UniRef50_Q25490 (53%/83)
Cluster: Apolipophorins precursor [Contains: Apolipophorin-2 (Apolipophorin II) (apoLp-2); Apolipophorin-1 (Apolipophorin I) (apoLp-1)]; n=5; Ditrysia|Rep: Apolipophorins precursor [Contains: Apolipophorin-2 (Apolipophorin II) (apoLp-2); Apolipophorin-1 (Apolipophorin I) (apoLp-1)] - Manduca sexta (Tobacco hawkmoth) (Tobacco hornworm)
Ontology
GO:0005319 F lipid transporter activity
GO:0006810 P transport
GO:0006869 P lipid transport
GO:0008289 F lipid binding
GO:0016055 P Wnt receptor signaling pathway
Orthologue
Sequence
(Nucleotide)
GACCACTGTAACGTACCCAACCAGCAGTGACTCTCCGTATATATTCAGCGGAGAGGCCTG
CCTCGACCTGGATAAGAAGAAACAGGGACACAAGACCTCTGTTAGATACCTCATCAACAT
CTCCAATAATAGGAATCAGGAAGCTATTGCAGCCGAAATCGGATTCTTCCACCCAAGATT
TGATAAGGAGGTAGTCATCAAGTCGAACGCAGTCTTCAAGGTCCCGGAACCAAATCGATA
TATTCTCGAATCATAGTCAGCCTATGTCACTCCTCTCTCGGCGCTGATCGCGTCTCCAAA
CTGTTGTTAGATGTTTCACCAACCAAATTCGTTTTCTTGGCCCAAACACCATTTGTAAAG
GTTATAGACTTAGAAGGAACAGTGGACGTGCAAAGCAAGGCGAAGACCCAGCAGGCCAAG
TTGAGGTTCAAGCTTCTAGAGGGCAAGGAGGTCAGCGTCCAGGCTCTGGCGAAAGACTTC
CAGTATTTCGNGTTCACAACAGAAGAGGAGACCGCAAGCTCTCTATCGTCGGTCATTTGG
TCCCGGAAAAGAGAGTAGATATAACCGCTGATATCATCCTATCTGGTGACAAGAAAAA
(598 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).