SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0032
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf95
1426125 bp
UniRef
UniRef50_UPI00015B63E8 (36%/46)
Cluster: PREDICTED: hypothetical protein; n=1; Nasonia vitripennis|Rep: PREDICTED: hypothetical protein - Nasonia vitripennis
Ontology
GO:0005215 F transporter activity
GO:0006810 P transport
GO:0016021 C integral to membrane
GO:0004872 F receptor activity
Orthologue
Sequence
(Nucleotide)
GCAAGCAATGTCTAGCACCGTACAAGCTGTATGGTGTTACCGTGAAGAATGAGCTTAGTT
CGGTTCTGAAGGAGAAGAGGCCGAGCTCGAGAGATGACGCGGGAGACGGCGGTGAAGAAG
ATGAAGAAGAGAGCTTAGTGGAACCACTGGACGACTCCTGCGTGGGGAAGTACATGGACC
GCATCANCCGNGTCCTAGCTTCGGTCAGAGGAAGACTGGCACAAGACGAGGAATTCTTTT
TAGAGCNTCGGAACGAGATCANCAGGACGCGGCGAACTCTATAATGGGTATNGTGGTCGA
NAACATCGAACCTCACATCCACTGGAAGCCGCAGCTGATCGACGGAATCCTCAAGTACGG
AGACAGGGTCCANACGATGTCTCTGCCCAGAGCTTCTGCTCCGCCAGGAGCTACGCCCCA
ACGAGATTATCGACCAGTTCCACGTCACCAATTTTAATGTCAGACTAGAGATTGANAGCG
AACTGTNACAGGCGAACTGAAAGCTGGAAAACAGGTGCCGTACTTAACTTGAAGAGAGCC
ATCAATAGATTCTTTGAAAGCTACAAGCACGGANTGATTTGCGCTAAGTTCATACTGCGT
TGCGGTGTGGAAAGCCACAGACGACNAGGCTATTTGCCTGTGGGAGCC
(648 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).