SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0026
JBrowseBomo_Chr8
chromosome_No.
Scaffold_id
Scaffold Length
chromo8
Bm_scaf19
6098939 bp
UniRef
UniRef50_Q5MGF5 (51%/47)
Cluster: Putative uncharacterized protein; n=2; Bombycoidea|Rep: Putative uncharacterized protein - Lonomia obliqua (Moth)
Ontology
GO:0004219 F pyroglutamyl-peptidase I activity
GO:0005737 C cytoplasm
GO:0006508 P proteolysis
GO:0008233 F peptidase activity
GO:0008234 F cysteine-type peptidase activity
Orthologue
Sequence
(Nucleotide)
CCTTAATCAACATAGTAGCTTTTATACCTGCGTATCGCTCGAAGAGAACAAAAATTAAAG
GAACATGGGGCTTCTAGCTGCATTAGTGGTAAACGCGGTCGGCGGTGCTGTAATATATGG
CACTGGGGGTCTGTTGACTCCATTAGTGGCTCCCGTGCTCGGTTTCAGCTCAGCGGGAAT
AGCGGCAGGAAGCACAGCCGCTGCTGCACAAGCATACTACGGAAATTTAGTGGCCGGCAG
CATTGTGTCACAGTGACTGCTGCTGCCATGGTAGCCCCCACGCCATGAGGTGATGCTAAA
CATCACCCGTTCTCNACATCGCTCCAGGATCGGACCTTTTCTGTNTTATTTGGAATTAAA
ATGCATTTAAATTTTTAATNAATTTGTCGATGCGATGTA
(399 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).