SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0024
JBrowseBomo_Chr26
chromosome_No.
Scaffold_id
Scaffold Length
chromo26
Bm_scaf98
1322498 bp
UniRef
UniRef50_P04142 (100%/63)
Cluster: Cecropin-B precursor; n=16; Obtectomera|Rep: Cecropin-B precursor - Bombyx mori (Silk moth)
Ontology
GO:0005576 C extracellular region
GO:0006955 P immune response
GO:0042742 P defense response to bacterium
GO:0045087 P innate immune response
Orthologue
Sequence
(Nucleotide)
GCCGCTTGTGTCTTAACGTCCGCGTTTGAATTTACATAAACTTACAATGAACTTCGCAAA
GATCCTATCCTTCGTCTTCGCTCTGGTGCTGGCTTTGAGCATGACCAGCGCTGCTCCCGA
GCCCAGGTGGAAGATCTTCAAGAAAATTGAAAAAATGGGCAGGAACATTCGTGACGGCAT
CGTCAAAGCGGGCCCGGCGATCGAGGTCCTCGGTTCGGCTAAAGCCATAGGAAAATAATC
TTTAAAACGTACGCATAAATACTAGTATTATTTAATCTACTCGTTAATTTTAATATGTAA
TTAAATTACAGCTTTAAGACTTAATAATAAGNCATTCAATTTTAAAAATAATTTGAAGTT
AATGTCTGCCAAAGTTTTCTTAGTGNTAAACGNTATGTTGTAAAATTGAAAATCAATAAA
ATATTTTGTACNTAATTCA
(439 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).