SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0018
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf28
4702674 bp
UniRef
UniRef50_UPI000069FA8B (27%/113)
Cluster: Protein bassoon (Zinc finger protein 231).; n=2; Xenopus tropicalis|Rep: Protein bassoon (Zinc finger protein 231). - Xenopus tropicalis
Ontology
GO:0005515 F protein binding
GO:0005215 F transporter activity
GO:0006810 P transport
GO:0016021 C integral to membrane
Orthologue
Sequence
(Nucleotide)
CTAAAGCAATAAAATTTCAGTGAATATATTACATTTACATAATCATGGCACTACAGCGAG
CGCGCCACACTGATGCTTTACAGCGTATTATGATTTCTTTCAAGCATTTCGAAAAGAAAC
TTGATAAATTACAAGATGACGTAAACGACCACGGCAAAACTTTAGGTGACCTCAAGACTA
TGGTGAGCAAACTTTCACAAAATACAGTAATCGGTCCTGAAAGCAAGCTCGACGATTGGA
GGGTACCTTTCAAGCGTCTGCATCAGTACAGTACGAAGAAACAAAAAGAGATTCATGCTC
TGTTCCCAAGAGAAAGAAAAACATACAGCCATTGCCAATTAAATCAAAAGCTAAGAGCTT
ACAAAATCAGAACATTATAGAAGCAGCGTTTCCAATTTCCGTTCCTCCAAAAATAATTAG
AAAACGTTCGCCTCGGACTCGTAAAGTCGAAACCCCTCGCAAAACTCCCACACTACGATC
CCACAAAGGCTTAGAAAATAAACACAGTAGCTAAAAGAGCAGATAGTGGAATGAAGAAGA
ATGATAGAAGAAGAAGNATGANAATGGAATGAAATGAATTGCTATTTAAATCAAATAATG
TTGATTATTCGTATTTTTCTTATAACGANGAGGTGTATTATTTGAANCAGGTTAAAATTC
ATGGGCAGTTACATAACA
(678 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).