SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2019/10/06
 
NametesS0011
JBrowseBomo_Scaf395
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf1453
4011 bp
UniRef
UniRef50_Q34505 (59%/72)
Cluster: Cytochrome c oxidase subunit I; n=46; Neoptera|Rep: Cytochrome c oxidase subunit I - Eueides tales
Ontology
GO:0004129 F cytochrome-c oxidase activity
GO:0005506 F iron ion binding
GO:0005507 F copper ion binding
GO:0005739 C mitochondrion
GO:0005746 C mitochondrial respiratory chain
Orthologue
Sequence
(Nucleotide)
CTTAAAATTGGTCGTTCATTATATGANTGNNCNGCTGGTGGTAAATTTTGATATCATTCA
ATTGATGANGGGAGATTTANAGAAAATAAGTTAATTCGTTNGTTANTTATTGATTCTCAA
ATAATAATTNNTATTATTATTACTGATAATCGAGAAATATATGAACCTAATGAAGAAATT
ATATTTCATGAAATATATGAGTCTGGNTAATCTGAATATCGTCGAGGTATTCCAGCTAAA
CCTAAAAAATGTTGGGANAAAATGTNATATTTACTCCAATAAATATTGTAAAANATTGAA
TTTTTAGTATNTNAGANTTTAATGAAAGGCCTGTAACATAAAGGNTATCAGCNTAATAAA
TCCCCCAATAATTGCANATACTGCTCCTATTGATAGAACATAATGAAANTGAGCTACTAC
ATNATAAGTATCATGTANTGTAATATCCAATAGNAGAATTGGCTAAAATTACACCTGTTA
ATCCTCCTACTGNGAATAAAAATACAAACCTAATCTTCATCANATATTAGGGTTATAATT
AATTTGAG
(548 bp)

The construction of this database has been supported by
Grant-in-Aid for Publication of Scientific Research Results,
JSPS, Japan (1999-2003, 2005-2018).

The EST sequencing was supported by the Genome Analysis Program,National Bioresource Project (NBRP),
Grants-in-Aid for Scientific Research, MEXT,and the Agrigenome Program, NIAS/MAFF.
The maintenance and distribution of the DNA clones are supported by the National Bioresource Project (NBRP).